Tweeting my genome #twenome

Inspired by “what if” over at xkcd, which looks at slightly silly questions from a scientific point of view, and spending a lot of time on Twitter these days, I asked myself

How long would it take for me to tweet my genome?

What follows is a very “back-of-the-envelope” set of calculations, and a set of questions which would need answering before a proper answer could be found.

A human genome is about 3 billion (3 000 000 000) letters long. A tweet can contain a maximum of 140 characters. 3 billion divided by 140 is 21 428 572. So that’s how many tweets would be needed to copy my genome.

Immediately, I should point out that there is a big margin of error on that number, which comes from using 3 billion exactly, rather than the actual number, which I don’t know (it doesn’t really matter for the level of precision we’re after here). It gets worse though, and becomes pretty meaningless quite quickly. It’s largely a matter of guesswork, just like the Drake equation for working out the probability of there being life in other parts of the Universe that we can detect.

So for our rough estimate purposes, we can use 20 million tweets for a human genome. The number would go up a bit if I were to include a hashtag in each tweet, such as #twenome, because there would only be room for 131 letters per tweet (there are 8 characters in “#twenome” and I would add a space for style). It would go up even further if I numbered or labelled the tweets, for instance with the chromosome they would correspond to, or whether they were part of a region with a known function. An added complication comes from mutations inherent in our cells – not every cell necessarily has quite the same genome, because the sequence undergoes largely harmless changes (fairly randomly) by itself due to a huge range of factors. Also, in the time it would take (see below), the genome of the cell I did choose would also undergo mutations, so the chances are the published sequence would be wrong by the time I got to the end!

So how long would it take to publish those?

Suddenly, this task becomes a real challenge. Several extra questions come up, which would all need to be resolved if we were to come up with a real answer.

• Would I be typing the tweets? Pushing the tweets out through a program, which probably wouldn’t be too hard to write for someone with the necessary skills, would obviously make this whole process go a lot faster than doing it by hand.
• Would I be using a keyboard, or a phone? My rate of typing, including the error rate, varies a lot between the two.
• Would I have to memorise the sequence first, or would I be copying from somewhere, or even have it dictated to me? This would again affect how fast I could go.
• How fast would Twitter be able to handle the tweets? It’s not a simple of case of me typing actgcgctagatcagtacga in a row, there are interruptions every 140 characters to send each tweet when it’s ready. This is also a question of how fast my internet connection is.
• Would I be allowed to take breaks? I think my typing probably deteriorates over extended periods of time.
• Would I injure myself? Repeated strain injury and erosion of my fingers are two potential health risks I can think of off the top of my head.
• Would my keyboard wear out? 3 billion keystrokes seems like a lot, especially when you consider they’d only be borne by 4 keys – a, c, t and g.

Nonetheless, we can still get at a solution, even by ignoring these questions. Here is a table of how long it would take to send 20 million tweets, as a function of how often they are sent. I start with 20 million days, then divide by 365 to get the 1-per-year rate, then by 24 to get the 1-per-hour rate, and finally by 60 to get 1-per-minute. One tweet per minute works out as seven keystrokes every three seconds. That’s not especially fast typing, but you wouldn’t have much time for anything else.

Other considerations:

• Who has even ever sent that many tweets? Is it even possible from a single Twitter account? According to Twitaholic, the most prolific Twitter account is “Yougakudan_00″, with over 3 million Tweets, but that seems to be a bot just pushing out random-looking numbers…
• How does 20 million compare with the total number of tweets there have ever been? Wikipedia says Twitter deals with 340 million tweets per day, so it’s not a huge amount.
• When could I even start tweeting? Even if I wanted to, I would not be able to send the first tweet of my own genome until I had the sequence (i.e. the series of letters) spelt out. I haven’t had mine sequenced yet… although Moore’s Law suggests that by the time I have enough cash to afford it at today’s prices, the cost will have gone down to a level I could probably already afford!

Now, aren’t you just glad our genome isn’t as big as those of plants?

UPDATE: This article was linked to from Ed Yong’s Not Exactly Rocket Science “Missing Links” page!